Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00029690
Genome
Vibrio cholerae - NC_012668.1
TF
HapR [UniProtKB:A0A0H3Q915, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTATTGAAAGGAAATAGCCATG - [2134437, 2134458] 19276207 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details PSSM site search (ECO:0005659) - 924

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VCD_002932 VCD_002931 VCD_002930 VCD_002929 VCD_002928 VCD_002933
Gene Locus tag Description
VCD_002932 VCD_002932 Hcp protein
VCD_002931 VCD_002931 VgrG protein
VCD_002930 VCD_002930 hypothetical protein
VCD_002929 VCD_002929 lipase family protein
VCD_002928 VCD_002928 hypothetical protein
VCD_002933 VCD_002933 thermostable carboxypeptidase 1