Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000296b0
Genome
Vibrio cholerae - NC_012668.1
TF
HapR [UniProtKB:A0A0H3Q915, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTATTGATGATTCTTTAAATAG - [1065103, 1065124] 19276207 Experimental technique details Comparative genomics search (ECO:0005622) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details PSSM site search (ECO:0005659) - 924

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VCD_001979 VCD_001980
Gene Locus tag Description
VCD_001979 VCD_001979 sensory box/GGDEF family protein
VCD_001980 VCD_001980 aerobic respiration control sensor protein ArcB