Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00029750
Genome
Vibrio cholerae - NC_012668.1
TF
HapR [UniProtKB:A0A0H3Q915, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTATTGATAAAGATGTAGTCTT - [2664626, 2664647] 19276207 Experimental technique details Comparative genomics search (ECO:0005622) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details PSSM site search (ECO:0005659) - 925

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VCD_003401 VCD_003400 VCD_003399 VCD_003398 VCD_003397 VCD_003396 VCD_003402
Gene Locus tag Description
VCD_003401 VCD_003401 Capsular polysaccharide synthesis enzyme CpsA sugar transferase
VCD_003400 VCD_003400 Capsular polysaccharide synthesis enzyme CpsB
VCD_003399 VCD_003399 Capsular polysaccharide synthesis enzyme CpsC polysaccharide export
VCD_003398 VCD_003398 Capsular polysaccharide synthesis enzyme CpsD exopolysaccharide synthesis
VCD_003397 VCD_003397 hypothetical protein VpsP
VCD_003396 VCD_003396 hypothetical protein VpsQ
VCD_003402 VCD_003402 hypothetical protein RbmF