Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00029760
Genome
Vibrio cholerae - NC_012668.1
TF
HapR [UniProtKB:A0A0H3Q915, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTAATGATTATTTTGTTATTTG - [7094, 7115] 19276207 Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - 925

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VCD_001024 VCD_001025
Gene Locus tag Description
VCD_001024 VCD_001024 hypoxanthine-guanine phosphoribosyltransferase
VCD_001025 VCD_001025 quorum-sensing regulator of virulence HapR