Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00029770
Genome
Vibrio cholerae - NC_012668.1
TF
HapR [UniProtKB:A0A0H3Q915, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTATTGATTTGTCGATAATAA - [2703337, 2703357] 24155884 Experimental technique details EMSA (ECO:0001807) - 926

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VCD_003432
Gene Locus tag Description
VCD_003432 VCD_003432 GGDEF domain family protein