Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000297d0
Genome
Streptococcus intermedius - NC_018073.1
TF
LacR [UniProtKB:T1ZD52, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGTTTGACTTTGTTTTGTTT + [1323782, 1323801] 23798532 Experimental technique details DNA affinity purification (ECO:0005629) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Visual sequence inspection (nan) - 930

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... lacR lacD
Gene Locus tag Description
lacR SCIM_1151 lactose specific PTS system transcriptional repressor
lacD SCIM_1152 tagatose-1,6-bisphosphate aldolase