Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000297e0
Genome
Streptococcus intermedius - NC_018073.1
TF
LacR [UniProtKB:T1ZD52, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGCTTTATTTTGTTGTTTTT + [1321751, 1321770] 23798532 Experimental technique details DNA affinity purification (ECO:0005629) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Visual sequence inspection (nan) - 930

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SCIM_1148 SCIM_1147 SCIM_1146 lacC SCIM_1144 SCIM_1149 lacB
Gene Locus tag Description
SCIM_1148 SCIM_1148 PTS system transporter enzyme II protein
SCIM_1147 SCIM_1147 PTS system galactitol-specific transporter subunit IIB
SCIM_1146 SCIM_1146 PTS system transporter enzyme II protein
lacC SCIM_1145 tagatose-6-phosphate kinase
SCIM_1144 SCIM_1144 hypothetical protein
SCIM_1149 SCIM_1149 hypothetical protein
lacB SCIM_1150 galactose-6-phosphate isomerase