Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002b130
Genome
Xanthomonas oryzae - NC_007705.1
TF
HrpX [UniProtKB:Q9ZIP8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTCGTCGCCGCACACAGGAATTCAC - [4751979, 4752003] 16684113 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details GUS reporter gene assay (ECO:0005641) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 960

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... XOO_4208 XOO_4209
Gene Locus tag Description
XOO_4208 XOO_4208 hypothetical protein
XOO_4209 XOO_4209 hypothetical protein