Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002b2b0
Genome
Yersinia pestis - NC_005810.1
TF
OmpR [UniProtKB:Q7CFX0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTTAAATGTTGTAACAATTT + [1956988, 1957007] 21345178 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 971

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... phoP phoQ YP_1762
Gene Locus tag Description
phoP YP_1764 DNA-binding transcriptional regulator PhoP
phoQ YP_1763 sensor protein PhoQ
YP_1762 YP_1762 hypothetical protein