Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002b2c0
Genome
Yersinia pestis - NC_005810.1
TF
OmpR [UniProtKB:Q7CFX0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTAACACTTAAATTCATTTT + [2015864, 2015883] 21345178 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 971

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ampD3
Gene Locus tag Description
ampD3 YP_1812 N-acetylmuramoyl-L-alanine amidase