Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002b2e0
Genome
Yersinia pestis - NC_005810.1
TF
OmpR [UniProtKB:Q7CFX0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AGCACAGTTTATTACATCTC - [611335, 611354] 21345178 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 971

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... rplU ispB rpmA rhaT3 obgE
Gene Locus tag Description
rplU YP_0571 50S ribosomal protein L21
ispB YP_0570 octaprenyl diphosphate synthase
rpmA YP_0572 50S ribosomal protein L27
rhaT3 YP_0573 hypothetical protein
obgE YP_0574 GTPase ObgE