Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002b300
Genome
Yersinia pestis - NC_005810.1
TF
OmpR [UniProtKB:Q7CFX0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GATCAGTTTTGTAACATTTG + [3402376, 3402395] 21345178 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 971

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... YP_3068 YP_3067 YP_3066 YP_3065 hcp7
Gene Locus tag Description
YP_3068 YP_3068 hypothetical protein
YP_3067 YP_3067 hypothetical protein
YP_3066 YP_3066 hypothetical protein
YP_3065 YP_3065 pseudo
hcp7 YP_3069 hypothetical protein