Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002b310
Genome
Yersinia pestis - NC_005810.1
TF
OmpR [UniProtKB:Q7CFX0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTTACCCATGATTTCATCTT - [3791962, 3791981] 21345178 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 971

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... cysM2 hutU hutH apt2 rhaT14 accC1
Gene Locus tag Description
cysM2 YP_3381 pyridoxal-phosphate dependent protein
hutU YP_3380 urocanate hydratase
hutH YP_3379 histidine ammonia-lyase
apt2 YP_3382 adenine phosphoribosyltransferase
rhaT14 YP_3383 hypothetical protein
accC1 YP_3384 hypothetical protein