Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002c050
Genome
Shewanella sp. ANA-3 - NC_008577.1
TF
CRP [UniProtKB:A0KST7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTATTTGCTACTGATCACATTT - [2817930, 2817951] 19060154 Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 999

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... Shewana3_2342 Shewana3_2343 Shewana3_2344 Shewana3_2345 Shewana3_2341 Shewana3_2340
Gene Locus tag Description
Shewana3_2342 Shewana3_2342 arsenical resistance operon trans-acting repressor ArsD
Shewana3_2343 Shewana3_2343 arsenite-activated ATPase ArsA
Shewana3_2344 Shewana3_2344 arsenical pump membrane protein
Shewana3_2345 Shewana3_2345 arsenate reductase
Shewana3_2341 Shewana3_2341 molybdopterin oxidoreductase
Shewana3_2340 Shewana3_2340 4Fe-4S ferredoxin