Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002c0a0
Genome
Sinorhizobium meliloti - NC_020560.1
TF
WggR (ExpG) [UniProtKB:P96440, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTTCAAAACTTGAAGTAATTT - [983853, 983873] 18344362 Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - 1001

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... wgdA wgdB wggR wgcA
Gene Locus tag Description
wgdA SM2011_b21316 ABC transporter,type I secretion system ATPase,required for secretion of WgeA (formerly ExpE1)
wgdB SM2011_b21315 Membrane-fusion protein
wggR SM2011_b21317 Transcriptional activator of exopolysaccharide II synthesis,binding to expA1,expG/expD1 and expE1 promotors,(formerly ExpG)
wgcA SM2011_b21318 Putative glycosyltransferase,forming alpha-glycosyl linkages protein WgcA (formerly ExpC)