Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002c110
Genome
Helicobacter pylori - NC_000915.1
TF
NikR [UniProtKB:O25896, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TAACACTAATTCATTTTAAATAATA - [78072, 78096] 22549756 Experimental technique details Fluorescence anisotropy (ECO:0005632) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 1004

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... HP0073 ureB
Gene Locus tag Description
HP0073 HP0073 urease subunit alpha
ureB HP0072 urease subunit beta