Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002c310
Genome
Shewanella oneidensis - NC_004347.2
TF
HnoC [UniProtKB:Q8EE50, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GTATAGGACAAATGTGACACGTTCAT + [2251533, 2251558] 24218564 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 1012

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SO_2144 SO_2145
Gene Locus tag Description
SO_2144 SO_2144 NO-binding heme-dependent sensor protein
SO_2145 SO_2145 two component signal transduction system histidine kinase