Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002c320
Genome
Shewanella oneidensis - NC_004347.2
TF
HnoC [UniProtKB:Q8EE50, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATCTATAAGACAAATAGGACAAATGCG + [2672047, 2672073] 24218564 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 1012

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SO_2541 SO_2540 SO_2544 SO_2543 SO_2542 SO_2538 SO_2539
Gene Locus tag Description
SO_2541 SO_2541 two component signal transduction system response regulator
SO_2540 SO_2540 two component signal transduction system response regulator
SO_2544 SO_2544 two component signal transduction system hybrid histidine kinase/response regulator with Hpt domain
SO_2543 SO_2543 two component signal transduction system histidine kinase
SO_2542 SO_2542 signaling protein with FIST domain
SO_2538 SO_2538 two component signal transduction system response regulator
SO_2539 SO_2539 two component signal transduction system response regulator with cyclic diguanylate phosphodiesterase activity and PAS sensory domain