Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002cd10
Genome
Helicobacter pylori - NC_011333.1
TF
NikR [UniProtKB:B5Z8Y5, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TAAAATTAACAATTATAATACAAAC + [1390795, 1390819] 16267295 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 1048

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... HPG27_1288 HPG27_1287 HPG27_1285 HPG27_1286 HPG27_1289
Gene Locus tag Description
HPG27_1288 HPG27_1288 biopolymer transport protein
HPG27_1287 HPG27_1287 biopolymer transport protein
HPG27_1285 HPG27_1285 nicotinate-nucleotide adenyltransferase
HPG27_1286 HPG27_1286 nickel responsive regulator
HPG27_1289 HPG27_1289 siderophore-mediated iron transport protein