Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002cd30
Genome
Helicobacter pylori - NC_011333.1
TF
NikR [UniProtKB:B5Z8Y5, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TAACACTAATTCATTTTAAATAATA - [79019, 79043] 16267295 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 1048

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ureB ureA
Gene Locus tag Description
ureB HPG27_67 urease subunit beta
ureA HPG27_68 urease subunit alpha