Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002cd50
Genome
Helicobacter pylori - NC_011333.1
TF
NikR [UniProtKB:B5Z8Y5, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TCGCATTTTAATGTAACTTATAAGA + [430536, 430560] 16267295 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details Western blot (quantitative) expression analysis (ECO:0000279) - 1048

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... HPG27_401
Gene Locus tag Description
HPG27_401 HPG27_401 ferric uptake regulation protein