Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002d4e0
Genome
Helicobacter pylori - NC_011333.1
TF
Fur [UniProtKB:B5Z6G7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTTTAATAATAATTATCATACTAT + [895821, 895844] 24322295 Experimental technique details Beta-gal reporter assay - Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Hydroxyl-radical footprinting (ECO:0005643) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 1065

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... HPG27_830 HPG27_829 HPG27_828 HPG27_827
Gene Locus tag Description
HPG27_830 HPG27_830 iron-regulated outer membrane protein
HPG27_829 HPG27_829 catalase
HPG27_828 HPG27_828 hypothetical protein
HPG27_827 HPG27_827 hypothetical protein