Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002d620
Genome
Dickeya dadantii - NC_014500.1
TF
Fur [UniProtKB:D2BRN2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TAATATTGAGAACCATTTACA + [3375162, 3375182] 12423024 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - 1071

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... fct Dda3937_03041 cbsH Dda3937_03039 Dda3937_03038 cbsC cbsE cbsB cbsA Dda3937_02430
Gene Locus tag Description
fct Dda3937_03042 ferrichrysobactin receptor
Dda3937_03041 Dda3937_03041 hypothetical protein
cbsH Dda3937_03040 chrysobactin oligopeptidase cbsH
Dda3937_03039 Dda3937_03039 MbtH-like protein
Dda3937_03038 Dda3937_03038 chrysobactin synthetase cbsF
cbsC Dda3937_02434 isochorismate hydroxymutase 2, chrysobactin biosynthesis
cbsE Dda3937_02433 2,3-dihydroxybenzoate-AMP ligase
cbsB Dda3937_02432 2,3-dihydro-2,3-dihydroxybenzoate synthetase
cbsA Dda3937_02431 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase
Dda3937_02430 Dda3937_02430 hypothetical protein