Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002d750
Genome
Bradyrhizobium diazoefficiens - NC_004463.1
TF
Fur [UniProtKB:H7C6Q1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GCCAGATGCAGTTGCAAATGAGTTGCAATAAGCTT - [5595038, 5595072] 19298371 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qPCR [quantitative real-time] (ECO:0005660) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 1076

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... mntH blr5045
Gene Locus tag Description
mntH bll5044 manganese transport protein MntH
blr5045 blr5045 blr5045