Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002d7e0
Genome
Corynebacterium glutamicum - NC_009342.1
TF
Zur [UniProtKB:Q8NNC4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTTTAATAAGCTTTCAATAAG + [165498, 165518] 23061624 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Visual sequence inspection (nan) - 1081

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... cgR_0148
Gene Locus tag Description
cgR_0148 cgR_0148 hypothetical protein