Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002d9f0
Genome
Helicobacter pylori - NC_000915.1
TF
NikR [UniProtKB:O25896, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GCATGAGTTCGTTAAAAGCCGCTCATGC + [1398794, 1398821] 12890020 Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details RNA dot blot (ECO:0001177) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 1095

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... HP1338 HP1337 HP1339 HP1340 HP1341
Gene Locus tag Description
HP1338 HP1338 nickel responsive regulator
HP1337 HP1337 hypothetical protein
HP1339 HP1339 biopolymer transport protein ExbB
HP1340 HP1340 biopolymer transport protein ExbD
HP1341 HP1341 siderophore-mediated iron transport protein TonB