Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002da80
Genome
Vibrio cholerae - NC_002505.1
TF
VpsR [UniProtKB:Q9KU59, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GAATTATTTTTGAGAAAAGTA - [998851, 998871] 25622616 Experimental technique details Comparative genomics search (ECO:0005622) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) - 1098

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... 1000000 VC0934 VC0932 VC0933 VC0935 VC0936 VC0939 VC0938 VC0937
Gene Locus tag Description
VC0934 VC0934 capsular polysaccharide biosynthesis glycosyltransferase
VC0932 VC0932 hypothetical protein
VC0933 VC0933 hypothetical protein
VC0935 VC0935 hypothetical protein
VC0936 VC0936 polysaccharide export-like protein
VC0939 VC0939 hypothetical protein
VC0938 VC0938 hypothetical protein
VC0937 VC0937 exopolysaccharide biosynthesis protein