Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002dba0
Genome
Salmonella enterica - NC_016856.1
TF
CueR [UniProtKB:A0A0F6AXY2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GACCTTAACCTTGCTGGAAGGTTTA - [561214, 561238] 20807206 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Western blot (quantitative) expression analysis (ECO:0000279) - 1102

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... cueR copA
Gene Locus tag Description
cueR STM14_0587 DNA-binding transcriptional regulator CueR
copA STM14_0586 copper exporting ATPase