Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002dcc0
Genome
Helicobacter pylori - NC_000915.1
TF
NikR [UniProtKB:O25896, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TATTACAATTACCAAAAAAGTATTA - [1136921, 1136945] 17522054 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Hydroxyl-radical footprinting (ECO:0005643) - Experimental technique details Premethylation interference footprinting (ECO:0005656) - 1106

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... HP1077
Gene Locus tag Description
HP1077 HP1077 nickel transport protein NixA