Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002dd90
Genome
Mycobacterium tuberculosis - NC_000962.3
TF
CsoR [UniProtKB:P9WP49, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GTAGCCCACCCCCAGTGGGGTGGGATAC + [1077917, 1077944] 17143269 Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details Visual sequence inspection (nan) - Experimental technique details X-ray crystallography (ECO:0005670) - 1109

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... Rv0968 csoR Rv0970 ctpV Rv0963c Rv0964c Rv0965c Rv0966c
Gene Locus tag Description
Rv0968 Rv0968 hypothetical protein
csoR Rv0967 Copper-sensitive operon repressor CsoR
Rv0970 Rv0970 Probable conserved integral membrane protein
ctpV Rv0969 Probable metal cation transporter P-type ATPase CtpV
Rv0963c Rv0963c hypothetical protein
Rv0964c Rv0964c Hypothetical protein
Rv0965c Rv0965c hypothetical protein
Rv0966c Rv0966c hypothetical protein