Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002de80
Genome
Streptococcus agalactiae - NC_004116.1
TF
AbiEi [UniProtKB:Q8DZ36, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGTTGCTTTTATACCACAAATAT + [1296450, 1296472] 24465005 Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 1114

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... abiGI abiGII ssp-5 SAG1282 SAG1281 SAG1280 SAG1279 SAG1278
Gene Locus tag Description
abiGI SAG1284 abortive infection protein AbiGI
abiGII SAG1285 abortive infection protein AbiGII
ssp-5 SAG1283 agglutinin receptor
SAG1282 SAG1282 calcium-binding protein
SAG1281 SAG1281 hypothetical protein
SAG1280 SAG1280 SNF2 family protein
SAG1279 SAG1279 hypothetical protein
SAG1278 SAG1278 hypothetical protein