Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002df00
Genome
Streptomyces coelicolor - NC_003888.3
TF
CsoR [UniProtKB:D6EK73, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAATACCCCTGGTGGGTATAT + [4551704, 4551724] 22451651 Experimental technique details EMSA (ECO:0001807) - Experimental technique details RNA-Seq (ECO:0005664) - Experimental technique details undecylprodigiosin (redD) reporter assay - 1117

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SCO4136 SCO4137 SCO4138
Gene Locus tag Description
SCO4136 SCO4136 hypothetical protein
SCO4137 SCO4137 hypothetical protein
SCO4138 SCO4138 phosphate transport protein