Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002df10
Genome
Streptomyces coelicolor - NC_003888.3
TF
CsoR [UniProtKB:D6EK73, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTATACCCCCTAGGGGTAAGG + [2976300, 2976320] 22451651 Experimental technique details EMSA (ECO:0001807) - Experimental technique details RNA-Seq (ECO:0005664) - 1117

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SCO2730 SCO2731 SCO2729
Gene Locus tag Description
SCO2730 SCO2730 regulator
SCO2731 SCO2731 cation-transporting P-type ATPase
SCO2729 SCO2729 acetyltransferase