Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002df20
Genome
Streptomyces coelicolor - NC_003888.3
TF
CsoR [UniProtKB:D6EK73, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GGGTACCCCCTAGGGGTATAC + [1100882, 1100902] 22451651 Experimental technique details EMSA (ECO:0001807) - Experimental technique details RNA-Seq (ECO:0005664) - 1117

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SCO1045 SCO1046 SCO1044
Gene Locus tag Description
SCO1045 SCO1045 metal associated protein
SCO1046 SCO1046 metal transporter ATPase
SCO1044 SCO1044 hypothetical protein