Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002df40
Genome
Bacillus subtilis - NC_000964.3
TF
CsoR [UniProtKB:O32222, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TACCCTACGGGGGTATGGTA - [3443859, 3443878] 18048925 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Visual sequence inspection (nan) - 1119

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... copZ copA
Gene Locus tag Description
copZ BSU33510 copper insertion chaperone and transporter
copA BSU33500 copper transporter ATPase