Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002e040
Genome
Ralstonia solanacearum - NC_003295.1
TF
HrpB [UniProtKB:P31778, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTCGGGCCAAATGCGAAACCTTCGC - [902786, 902810] 15225308 Experimental technique details Beta-gal reporter assay - Experimental technique details Consensus search (ECO:0005624) - 1121

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... RS_RS04330 RS_RS25165
Gene Locus tag Description
RS_RS04330 RS_RS04330 YOPP/AvrRxv family protein
RS_RS25165 RS_RS25165 hypothetical protein