| Binding site | Location | Publication | Experimental techniques used | Curation |
|---|---|---|---|---|
| TTCGCGAACGGAGACCACTTTTCGC | - [424322, 424346] | 15225308 |
|
1121 |
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Gene | Locus tag | Description |
|---|---|---|
| RS_RS18700 | RS_RS18700 | type III effector HopG1 |
| RS_RS18705 | RS_RS18705 | (2Fe-2S)-binding protein |
| RS_RS18710 | RS_RS18710 | carbon monoxide dehydrogenase |
| RS_RS18715 | RS_RS18715 | organic hydroperoxide resistance protein |
| RS_RS18720 | RS_RS18720 | molybdopterin-guanine dinucleotide biosynthesis protein MobA |