Binding site | Location | Publication | Experimental techniques used | Curation |
---|---|---|---|---|
TTCGGGCCGGGCCCGATTTCTTCGC | + [3542731, 3542755] | 15225308 |
|
1121 |
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Gene | Locus tag | Description |
---|---|---|
RS_RS16485 | RS_RS16485 | hypothetical protein |
RS_RS16480 | RS_RS16480 | ATP-dependent DNA helicase Rep |
RS_RS16490 | RS_RS16490 | hypothetical protein |