| Binding site | Location | Publication | Experimental techniques used | Curation | 
|---|---|---|---|---|
| TTCGGGCCGGGCCCGATTTCTTCGC | + [3542731, 3542755] | 15225308 | 
	      
          
 | 
        1121 | 
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Gene | Locus tag | Description | 
|---|---|---|
| RS_RS16485 | RS_RS16485 | hypothetical protein | 
| RS_RS16480 | RS_RS16480 | ATP-dependent DNA helicase Rep | 
| RS_RS16490 | RS_RS16490 | hypothetical protein |