| Binding site | Location | Publication | Experimental techniques used | Curation | 
|---|---|---|---|---|
| TTCGCCTGTTGCCGTGTTTTTTCGT | + [1443188, 1443212] | 15225308 | 
	      
          
 | 
        1121 | 
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Gene | Locus tag | Description | 
|---|---|---|
| RS_RS06800 | RS_RS06800 | GALA protein |