Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002e290
Genome
Ralstonia solanacearum - NC_003296.1
TF
HrpB [UniProtKB:P31778, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTCGCTTTTGGATGCGGCGCTTCG - [1071466, 1071489] 19406897 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details Cya fusion reporter (ECO:0006002) - 1122

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... RS_RS21170
Gene Locus tag Description
RS_RS21170 RS_RS21170 type III effector protein