Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002e2c0
Genome
Pseudomonas syringae group genomosp. 3 - NC_004578.1
TF
HrpL [UniProtKB:G3XDC4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGGAACTGAAATCGATGCTCGACCACTTA - [1536877, 1536905] 12207690 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Northern blot (ECO:0005653) - 1123

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... hrpP hrcU hrpO hrcQa hrcQb hrcR hrcS hrcT
Gene Locus tag Description
hrpP PSPTO_1398 type III secretion protein HrpP
hrcU PSPTO_1392 type III secretion protein HrcU
hrpO PSPTO_1399 type III secretion protein HrpO
hrcQa PSPTO_1397 type III secretion protein HrcQa
hrcQb PSPTO_1396 type III secretion protein HrcQb
hrcR PSPTO_1395 type III secretion protein HrcR
hrcS PSPTO_1394 type III secretion protein HrcS
hrcT PSPTO_1393 type III secretion protein HrcT