Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002e2d0
Genome
Pseudomonas syringae group genomosp. 3 - NC_004578.1
TF
HrpL [UniProtKB:G3XDC4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGGAACCCGCTGGCATTGCATGCCACTCA - [1519573, 1519601] 12207690 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Northern blot (ECO:0005653) - 1123

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... avrE1 hrpH
Gene Locus tag Description
avrE1 PSPTO_1377 type III effector protein AvrE1
hrpH PSPTO_1378 membrane-bound lytic murein transglycosylase D