Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002e2e0
Genome
Pseudomonas syringae group genomosp. 3 - NC_004578.1
TF
HrpL [UniProtKB:G3XDC4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GGGAACCGGTCGCTGCGCTTTGCCACTCA - [1510788, 1510816] 12207690 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Northern blot (ECO:0005653) - 1123

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... hrpW1 shcM hopM1 shcE
Gene Locus tag Description
hrpW1 PSPTO_1373 type III helper protein HrpW1
shcM PSPTO_1374 type III chaperone ShcM
hopM1 PSPTO_1375 type III effector HopM1
shcE PSPTO_1376 type III chaperone ShcE