Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002e320
Genome
Ralstonia solanacearum - NC_003296.1
TF
VsrD [UniProtKB:Q8XVU0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AATCCCCTCTAAATTGGGGATT - [1265657, 1265678] 9573161 Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Visual sequence inspection (nan) - 1126

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... RS_RS21960 RS_RS21955 RS_RS21950 RS_RS21965
Gene Locus tag Description
RS_RS21960 RS_RS21960 transcriptional regulator
RS_RS21955 RS_RS21955 TEK signal peptide protein
RS_RS21950 RS_RS21950 hypothetical protein
RS_RS21965 RS_RS21965 dTDP-glucose 4,6-dehydratase