Curation Information

Publication: A membrane-associated protein, FliX, is required for an early step in Caulobacter flagellar assembly.;Mohr CD, MacKichan JK, Shapiro L;Journal of bacteriology 1998 Apr; 180(8):2175-85 [9555902]
TF: CtrA [P0CAW8, view regulon]
Reported TF sp.: Caulobacter crescentus NA1000
Reported site sp.: Caulobacter crescentus NA1000
Created by: Dinara Sagitova
Curation notes: -

Experimental Process

fliX-lacZ fusion in the C.crescentus strain showed that fliX expression was reduced by over 50% as a result of inactivation of ctrA. S1 nuclease protection assays determined fliX transcription start sites. Visual sequence inspection of the fliX promoter revealed a sequence with a seven out of nine bases match to the CtrA consensus sequence. DNase I footprinting determined that in the presence of CtrA, a single 17 bp region, partially overlapping the predicted binding motif, was protected.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

TTGAAGTATGGTTAATGCCGG

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
TTGAAGTATGGTTAATGCCGG	fliX,		Experimental technique details Beta-gal reporter assay Beta-gal reporter assay Reporter assay using the beta-galactosidase (lacZ) gene. The lacZ gene is typically fused to the promoter of interest. Differential regulation of the promoter mediated by the TF is assessed by induction of the system and evaluation of lacZ expression. Bacteria expressing lacZ appear blue when grown on a X-gal medium. The assay is often performed using a plasmid borne construction on a lacZ(def) strain. - Experimental technique details DNAse footprinting (ECO:0005631) DNAse footprinting - ECO:0005631 The DNAse foot-printing method starts by focusing on a given region of interest (e.g. a promoter region) and amplifying it by PCR to obtain lots of sample. It then throws in the TF and then the DNAse. The mix is left to stir for a short time and then gel electrophoresis is run to compare the pattern of fragments in a control (no TF) and in the sample. If the TF has bound the sample, it will have protected a stretch of DNA (encompassing some fragments of the control) and thus those fragments will not appear in the sample gel. The fragments can then be cut-out from the gel, purified and sequenced to obtain the sequence of the protected region. This is often used to identify the binding motif of a TF for the first time. The foot-printing will typically resolve the protected region down to 50-100 bp, and the sequence can be then examined for possible TF-binding sites either by eye of using a computer search. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge -	activator	not specified