Curation Information

Publication: Molecular mechanisms of HipA-mediated multidrug tolerance and its neutralization by HipB.;Schumacher MA, Piro KM, Xu W, Hansen S, Lewis K, Brennan RG;Science (New York, N.Y.) 2009 Jan 16; 323(5912):396-401 [19150849]
TF: HipB [P23873, view regulon], [P23874, view regulon]
Reported TF sp.: Escherichia coli str. K-12 substr. MG1655
Reported site sp.: Escherichia coli str. K-12 substr. MG1655
Created by: Erill Lab
Curation notes: -

Experimental Process

Structure of complex HipAB with section of hipAB promoter solved verifies sequence ACTATCCCCTTAAGGGGATAG as a palidromic binding unit for the complex.

The paper reports that TF forms complex with other proteins for binding with reported sites.

HipB in complex with HipA

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

TATCCGCTTAAGGGGATA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
TATCCGCTTAAGGGGATA			Experimental technique details X-ray crystallography (ECO:0005670) X-ray crystallography - ECO:0005670 X-ray crystallography is a method to determine the molecular structure of a crystal that is typically used to probe at the tridimensional structure of proteins. In some cases, it is possible to co-crystallize the protein bound to its DNA binding site, providing detail on the particular arrangement of the two components. Doing so provides, obviously, unequivocal evidence of binding. -	repressor	dimer