Northern blotting experiments proved NikR represses transcription of FecA3 and FrpB4 genes. Quantitative phenotypic analysis of outer membrane protein production confirmed that this transcriptional repression leads to decreased expression. DNase I footprinting both validated binding of NikR to both promoters and localized the binding sites.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| TATTATTAAATAGAATAATGTAATA | HP1512 |
|
repressor | not specified | |
| CATTATTAAGTTTTTTTTGTTTTTA | HP1400 |
|
repressor | not specified |