Curation Information

Publication
Corynebacterium glutamicum Zur acts as a zinc-sensing transcriptional repressor of both zinc-inducible and zinc-repressible genes involved in zinc homeostasis.;Teramoto H, Inui M, Yukawa H;The FEBS journal 2012 Dec; 279(23):4385-97 [23061624]
TF
Zur [Q8NNC4, view regulon]
Reported TF sp.
Corynebacterium glutamicum R
Reported site sp.
Corynebacterium glutamicum R
Created by
Grace Chandler
Curation notes
-

Experimental Process

qRT-PCR was used to show Zur mediated repression of znu, zrf, and zra genes. Beta-gal fusion assays further confirmed Zn-dependent induction of the zrf and zra expression. EMSA confirmed Zur specific binding to the promoters of these genes. DNase I footprinting localized these Zur binding sites and further confirmed binding Visual sequence inspection and multiple sequence alignment identified a putative Zur consensus sequence.

Transcription Factor Binding Sites


TTTCAATAAGCTTTCAATAAG
TTTTAATAAGCTTTCAATAAG
TGTTGACAGCTGTTTTCAATA
TTTCAATAAGCTTTCAATAAG
TTTTAATAAGCTTTCAATAAG
TGTTGACAGCTGTTTTCAATA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TTTCAATAAGCTTTCAATAAG cgR_1359,
... ... cgR_1359 cgR_1360 cgR_1361
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Visual sequence inspection (nan) - repressor not specified
TTTTAATAAGCTTTCAATAAG cgR_0148
... ... cgR_0148
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Visual sequence inspection (nan) - repressor not specified
TGTTGACAGCTGTTTTCAATA cgR_2534,
... ... cgR_2534 cgR_2535 cgR_2536 cgR_2537
Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Visual sequence inspection (nan) - repressor not specified