Putative binding sights for HpNikR in the promoter regions of ureA and nixA were identified from previous publications. DNAse I, hydroxyl radical (Fe-EDTA), and dimethyl sulfate (DMS) protection supported the locations of predicted half-sites.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| TAACACTAATTCATTTTAAATAATA |
|
activator | tetramer | ||
| TATTACAATTACCAAAAAAGTATTA |
|
repressor | tetramer |