Visual sequence inspection of a promoter region shown to be involved in copper resistance allowed identification of a potential palindromic binding site. EMSAs showed that the purified Rv0967 gene product (CsoR) binds specifically to this region, and that binding is copper dependent. GFP revealed that CsoR drives represses its own operon. The crystal structure of CsoR shows that it binds as a homodimer
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
GTAGCCCACCCCCAGTGGGGTGGGATAC | Rv0968, csoR, |
|
repressor | dimer |